Review



trackrna idt integrated dna technologies  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc trackrna idt integrated dna technologies
    Trackrna Idt Integrated Dna Technologies, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trackrna+idt+integrated+dna+technologies/RNA+motif+plasmid+cloning+backbone+(Plasmid+%23107253)/pm38749447-659-49-69
    Average 93 stars, based on 13 article reviews
    trackrna idt integrated dna technologies - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Expression of the membrane tetraspanin claudin 18 on cancer cells promotes T lymphocyte infiltration and antitumor immunity in pancreatic cancer.
    Article Snippet: GSE230868 Experimental models: Cell lines 293 [HEK-293] ATCC Cat#CRL-1573 RRID:CVCL_9804 FC1199 D. Tuveson Laboratory N/A FC1242 D. Tuveson Laboratory N/A hTERT-specific T cells S. Sandri et al. Sandri at al.35 DANG Ӧ. T€ureci and U. Sahin T€ureci et al.62 DANG-CLDN18 Ӧ. T€ureci and U. Sahin T€ureci et al.62 MBL-2 cells ATCC Cat#HB-193 RRID:CVCL_G236 Experimental models: Organisms/strains Mouse: C57BL/6NCrl Charles River Laboratory Cat#C57BL/6NCrl RRID:MGI:2683688 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J Jackson Laboratory Cat#003831 RRID:IMSR_JAX:003831 Mouse: C57BL/6NTac.Cg-Rag2tm1Fwa Il2rgtm1Wjl Taconic Biosciences Cat#4111 Mouse: NOD Cg-PrkdcscidIl2rgtm 1 Sug/YicTac Taconic Biosciences Cat#NODSC Mouse: LSL-KrasG12D/+ The Jackson Laboratory Strain #:008179 RRID:IMSR_JAX:008179 Mouse: LSL-Trp53R172H/+ The Jackson Laboratory Strain #:008652 RRID:IMSR_JAX:008652 Mouse: CLDNflox/flox Zea Borok Zhou et al.63 Mouse: KPCldnfl/fl (LSL-KrasG12D/+ LSL-Trp53R172H/+ CLDNflox/flox) This paper N/A (Continued on next page) Immunity 57, 1378–1393.e1–e14, June 11, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides siRNA targeting sequence: ALCAM CGAUGAGGCAGACGAUAUA GCAGUGGGAGCGUCAUAAA UGGCAGGUAUUAUAGUAAA GCACAAUAUCUGCAAGUAG Horizon discovery Cat# LQ-042896-00-0010 siRNa targeting sequence: SCRAMBLE UGGUUUACAUGUCGACUAA UGGUUUACAUGUUGUGUGA Horizon discovery Cat# D-001810-10-20 crRNA CRISPR CLDN18 GATGATCGTAGGCATCGTCC GCCCTGAAATGCATCCGCAT GCCAACATGACACTGACCTC IDT Integrated DNA technologies Alt-R CRISPR-Cas9 crRNA Cas9 protein IDT Integrated DNA technologies Cat# 1081058 trackRNA IDT Integrated DNA technologies Cat# 1072534 Recombinant DNA pELNS-OVA-GFP G. Coukos et al. Motz et al.64 Lenti-LucOS Tyler Jacks Addgene #22777 DuPage et al.38 pELNS-GFP-CLDN18-His This paper N/A Software and algorithms Living Image Software 4.4 Perkin Elmer https://resources.perkinelmer.com/ corporate/content/lst_software_ downloads/living_image_44_release_ notes.pdf Multichip Average Algorithm (RMA) CRAN Irizarry et al.65; Bolstad et al.66; Irizarry et al.67 Limma package Bioconductor Ritchie et al.68 DAVID web application G.Dennis Jr et al. Dennis et al.69 R package ‘GSVA’ 1.46.0 Bioconductor H€anzelmann et al.27 R package ‘rms’ 6.5-0 CRAN https://CRAN.R-project.org/ package=maxstat R package ‘survival’ 3.5-3 CRAN https://CRAN.R-project.org/ package=maxstat R package ’maxstat’ 0.7-2.5 CRAN https://CRAN.R-project.org/ package=maxstat R package ’survminer’ 0.4.9 CRAN https://CRAN.R-project.org/ package=survminer R package ’RTCGA’ 1.28.0 Github https://rtcga.github.io/RTCGA PAAD, LUAD and LUSC TCGA datasets Cancer Genome Atlas Research Network Cancer Genome Atlas Research, N.32 R package ’curatedTCGAData’ 1.20.1 Bioconductor Ramos et al.70 R package ’ggpubr’ 0.6.0 N/A https://CRAN.R-project.org/ package=ggpubr R package ’DESeq2’ 1.38.3 Bioconductor N/A R package ’biomaRt’ 2.54.0 Bioconductor N/A R package ’ComplexHeatmap’ 2.14.0 Bioconductor Gu et al.71 R package ’ggplot2’ 3.4.1 CRAN N/A GSVA scores on immune gene sets M S Rooney et al. Rooney et al.72 GSVA scores on T cells low and T cell high tumor samples J Li et al. Li et al.26 FlowJo software BD Biosciences https://www.flowjo.com/solutions/flowjo/ downloads ImageJ software Fiji https://imagej.net/software/fiji/downloads (Continued on next page) e5 Immunity 57, 1378–1393.e1–e14, June 11, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Zen v3.5 software Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html GraphPad Prism GraphPad https://www.graphpad.com/features Imaris software Imaris https://imaris.oxinst.com/

    CRISPR:

    Article Title: Expression of the membrane tetraspanin claudin 18 on cancer cells promotes T lymphocyte infiltration and antitumor immunity in pancreatic cancer.
    Article Snippet: GSE230868 Experimental models: Cell lines 293 [HEK-293] ATCC Cat#CRL-1573 RRID:CVCL_9804 FC1199 D. Tuveson Laboratory N/A FC1242 D. Tuveson Laboratory N/A hTERT-specific T cells S. Sandri et al. Sandri at al.35 DANG Ӧ. T€ureci and U. Sahin T€ureci et al.62 DANG-CLDN18 Ӧ. T€ureci and U. Sahin T€ureci et al.62 MBL-2 cells ATCC Cat#HB-193 RRID:CVCL_G236 Experimental models: Organisms/strains Mouse: C57BL/6NCrl Charles River Laboratory Cat#C57BL/6NCrl RRID:MGI:2683688 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J Jackson Laboratory Cat#003831 RRID:IMSR_JAX:003831 Mouse: C57BL/6NTac.Cg-Rag2tm1Fwa Il2rgtm1Wjl Taconic Biosciences Cat#4111 Mouse: NOD Cg-PrkdcscidIl2rgtm 1 Sug/YicTac Taconic Biosciences Cat#NODSC Mouse: LSL-KrasG12D/+ The Jackson Laboratory Strain #:008179 RRID:IMSR_JAX:008179 Mouse: LSL-Trp53R172H/+ The Jackson Laboratory Strain #:008652 RRID:IMSR_JAX:008652 Mouse: CLDNflox/flox Zea Borok Zhou et al.63 Mouse: KPCldnfl/fl (LSL-KrasG12D/+ LSL-Trp53R172H/+ CLDNflox/flox) This paper N/A (Continued on next page) Immunity 57, 1378–1393.e1–e14, June 11, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides siRNA targeting sequence: ALCAM CGAUGAGGCAGACGAUAUA GCAGUGGGAGCGUCAUAAA UGGCAGGUAUUAUAGUAAA GCACAAUAUCUGCAAGUAG Horizon discovery Cat# LQ-042896-00-0010 siRNa targeting sequence: SCRAMBLE UGGUUUACAUGUCGACUAA UGGUUUACAUGUUGUGUGA Horizon discovery Cat# D-001810-10-20 crRNA CRISPR CLDN18 GATGATCGTAGGCATCGTCC GCCCTGAAATGCATCCGCAT GCCAACATGACACTGACCTC IDT Integrated DNA technologies Alt-R CRISPR-Cas9 crRNA Cas9 protein IDT Integrated DNA technologies Cat# 1081058 trackRNA IDT Integrated DNA technologies Cat# 1072534 Recombinant DNA pELNS-OVA-GFP G. Coukos et al. Motz et al.64 Lenti-LucOS Tyler Jacks Addgene #22777 DuPage et al.38 pELNS-GFP-CLDN18-His This paper N/A Software and algorithms Living Image Software 4.4 Perkin Elmer https://resources.perkinelmer.com/ corporate/content/lst_software_ downloads/living_image_44_release_ notes.pdf Multichip Average Algorithm (RMA) CRAN Irizarry et al.65; Bolstad et al.66; Irizarry et al.67 Limma package Bioconductor Ritchie et al.68 DAVID web application G.Dennis Jr et al. Dennis et al.69 R package ‘GSVA’ 1.46.0 Bioconductor H€anzelmann et al.27 R package ‘rms’ 6.5-0 CRAN https://CRAN.R-project.org/ package=maxstat R package ‘survival’ 3.5-3 CRAN https://CRAN.R-project.org/ package=maxstat R package ’maxstat’ 0.7-2.5 CRAN https://CRAN.R-project.org/ package=maxstat R package ’survminer’ 0.4.9 CRAN https://CRAN.R-project.org/ package=survminer R package ’RTCGA’ 1.28.0 Github https://rtcga.github.io/RTCGA PAAD, LUAD and LUSC TCGA datasets Cancer Genome Atlas Research Network Cancer Genome Atlas Research, N.32 R package ’curatedTCGAData’ 1.20.1 Bioconductor Ramos et al.70 R package ’ggpubr’ 0.6.0 N/A https://CRAN.R-project.org/ package=ggpubr R package ’DESeq2’ 1.38.3 Bioconductor N/A R package ’biomaRt’ 2.54.0 Bioconductor N/A R package ’ComplexHeatmap’ 2.14.0 Bioconductor Gu et al.71 R package ’ggplot2’ 3.4.1 CRAN N/A GSVA scores on immune gene sets M S Rooney et al. Rooney et al.72 GSVA scores on T cells low and T cell high tumor samples J Li et al. Li et al.26 FlowJo software BD Biosciences https://www.flowjo.com/solutions/flowjo/ downloads ImageJ software Fiji https://imagej.net/software/fiji/downloads (Continued on next page) e5 Immunity 57, 1378–1393.e1–e14, June 11, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Zen v3.5 software Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html GraphPad Prism GraphPad https://www.graphpad.com/features Imaris software Imaris https://imaris.oxinst.com/

    Recombinant:

    Article Title: Expression of the membrane tetraspanin claudin 18 on cancer cells promotes T lymphocyte infiltration and antitumor immunity in pancreatic cancer.
    Article Snippet: GSE230868 Experimental models: Cell lines 293 [HEK-293] ATCC Cat#CRL-1573 RRID:CVCL_9804 FC1199 D. Tuveson Laboratory N/A FC1242 D. Tuveson Laboratory N/A hTERT-specific T cells S. Sandri et al. Sandri at al.35 DANG Ӧ. T€ureci and U. Sahin T€ureci et al.62 DANG-CLDN18 Ӧ. T€ureci and U. Sahin T€ureci et al.62 MBL-2 cells ATCC Cat#HB-193 RRID:CVCL_G236 Experimental models: Organisms/strains Mouse: C57BL/6NCrl Charles River Laboratory Cat#C57BL/6NCrl RRID:MGI:2683688 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J Jackson Laboratory Cat#003831 RRID:IMSR_JAX:003831 Mouse: C57BL/6NTac.Cg-Rag2tm1Fwa Il2rgtm1Wjl Taconic Biosciences Cat#4111 Mouse: NOD Cg-PrkdcscidIl2rgtm 1 Sug/YicTac Taconic Biosciences Cat#NODSC Mouse: LSL-KrasG12D/+ The Jackson Laboratory Strain #:008179 RRID:IMSR_JAX:008179 Mouse: LSL-Trp53R172H/+ The Jackson Laboratory Strain #:008652 RRID:IMSR_JAX:008652 Mouse: CLDNflox/flox Zea Borok Zhou et al.63 Mouse: KPCldnfl/fl (LSL-KrasG12D/+ LSL-Trp53R172H/+ CLDNflox/flox) This paper N/A (Continued on next page) Immunity 57, 1378–1393.e1–e14, June 11, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides siRNA targeting sequence: ALCAM CGAUGAGGCAGACGAUAUA GCAGUGGGAGCGUCAUAAA UGGCAGGUAUUAUAGUAAA GCACAAUAUCUGCAAGUAG Horizon discovery Cat# LQ-042896-00-0010 siRNa targeting sequence: SCRAMBLE UGGUUUACAUGUCGACUAA UGGUUUACAUGUUGUGUGA Horizon discovery Cat# D-001810-10-20 crRNA CRISPR CLDN18 GATGATCGTAGGCATCGTCC GCCCTGAAATGCATCCGCAT GCCAACATGACACTGACCTC IDT Integrated DNA technologies Alt-R CRISPR-Cas9 crRNA Cas9 protein IDT Integrated DNA technologies Cat# 1081058 trackRNA IDT Integrated DNA technologies Cat# 1072534 Recombinant DNA pELNS-OVA-GFP G. Coukos et al. Motz et al.64 Lenti-LucOS Tyler Jacks Addgene #22777 DuPage et al.38 pELNS-GFP-CLDN18-His This paper N/A Software and algorithms Living Image Software 4.4 Perkin Elmer https://resources.perkinelmer.com/ corporate/content/lst_software_ downloads/living_image_44_release_ notes.pdf Multichip Average Algorithm (RMA) CRAN Irizarry et al.65; Bolstad et al.66; Irizarry et al.67 Limma package Bioconductor Ritchie et al.68 DAVID web application G.Dennis Jr et al. Dennis et al.69 R package ‘GSVA’ 1.46.0 Bioconductor H€anzelmann et al.27 R package ‘rms’ 6.5-0 CRAN https://CRAN.R-project.org/ package=maxstat R package ‘survival’ 3.5-3 CRAN https://CRAN.R-project.org/ package=maxstat R package ’maxstat’ 0.7-2.5 CRAN https://CRAN.R-project.org/ package=maxstat R package ’survminer’ 0.4.9 CRAN https://CRAN.R-project.org/ package=survminer R package ’RTCGA’ 1.28.0 Github https://rtcga.github.io/RTCGA PAAD, LUAD and LUSC TCGA datasets Cancer Genome Atlas Research Network Cancer Genome Atlas Research, N.32 R package ’curatedTCGAData’ 1.20.1 Bioconductor Ramos et al.70 R package ’ggpubr’ 0.6.0 N/A https://CRAN.R-project.org/ package=ggpubr R package ’DESeq2’ 1.38.3 Bioconductor N/A R package ’biomaRt’ 2.54.0 Bioconductor N/A R package ’ComplexHeatmap’ 2.14.0 Bioconductor Gu et al.71 R package ’ggplot2’ 3.4.1 CRAN N/A GSVA scores on immune gene sets M S Rooney et al. Rooney et al.72 GSVA scores on T cells low and T cell high tumor samples J Li et al. Li et al.26 FlowJo software BD Biosciences https://www.flowjo.com/solutions/flowjo/ downloads ImageJ software Fiji https://imagej.net/software/fiji/downloads (Continued on next page) e5 Immunity 57, 1378–1393.e1–e14, June 11, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Zen v3.5 software Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html GraphPad Prism GraphPad https://www.graphpad.com/features Imaris software Imaris https://imaris.oxinst.com/

    Software:

    Article Title: Expression of the membrane tetraspanin claudin 18 on cancer cells promotes T lymphocyte infiltration and antitumor immunity in pancreatic cancer.
    Article Snippet: GSE230868 Experimental models: Cell lines 293 [HEK-293] ATCC Cat#CRL-1573 RRID:CVCL_9804 FC1199 D. Tuveson Laboratory N/A FC1242 D. Tuveson Laboratory N/A hTERT-specific T cells S. Sandri et al. Sandri at al.35 DANG Ӧ. T€ureci and U. Sahin T€ureci et al.62 DANG-CLDN18 Ӧ. T€ureci and U. Sahin T€ureci et al.62 MBL-2 cells ATCC Cat#HB-193 RRID:CVCL_G236 Experimental models: Organisms/strains Mouse: C57BL/6NCrl Charles River Laboratory Cat#C57BL/6NCrl RRID:MGI:2683688 Mouse: C57BL/6-Tg(TcraTcrb)1100Mjb/J Jackson Laboratory Cat#003831 RRID:IMSR_JAX:003831 Mouse: C57BL/6NTac.Cg-Rag2tm1Fwa Il2rgtm1Wjl Taconic Biosciences Cat#4111 Mouse: NOD Cg-PrkdcscidIl2rgtm 1 Sug/YicTac Taconic Biosciences Cat#NODSC Mouse: LSL-KrasG12D/+ The Jackson Laboratory Strain #:008179 RRID:IMSR_JAX:008179 Mouse: LSL-Trp53R172H/+ The Jackson Laboratory Strain #:008652 RRID:IMSR_JAX:008652 Mouse: CLDNflox/flox Zea Borok Zhou et al.63 Mouse: KPCldnfl/fl (LSL-KrasG12D/+ LSL-Trp53R172H/+ CLDNflox/flox) This paper N/A (Continued on next page) Immunity 57, 1378–1393.e1–e14, June 11, 2024 e4 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides siRNA targeting sequence: ALCAM CGAUGAGGCAGACGAUAUA GCAGUGGGAGCGUCAUAAA UGGCAGGUAUUAUAGUAAA GCACAAUAUCUGCAAGUAG Horizon discovery Cat# LQ-042896-00-0010 siRNa targeting sequence: SCRAMBLE UGGUUUACAUGUCGACUAA UGGUUUACAUGUUGUGUGA Horizon discovery Cat# D-001810-10-20 crRNA CRISPR CLDN18 GATGATCGTAGGCATCGTCC GCCCTGAAATGCATCCGCAT GCCAACATGACACTGACCTC IDT Integrated DNA technologies Alt-R CRISPR-Cas9 crRNA Cas9 protein IDT Integrated DNA technologies Cat# 1081058 trackRNA IDT Integrated DNA technologies Cat# 1072534 Recombinant DNA pELNS-OVA-GFP G. Coukos et al. Motz et al.64 Lenti-LucOS Tyler Jacks Addgene #22777 DuPage et al.38 pELNS-GFP-CLDN18-His This paper N/A Software and algorithms Living Image Software 4.4 Perkin Elmer https://resources.perkinelmer.com/ corporate/content/lst_software_ downloads/living_image_44_release_ notes.pdf Multichip Average Algorithm (RMA) CRAN Irizarry et al.65; Bolstad et al.66; Irizarry et al.67 Limma package Bioconductor Ritchie et al.68 DAVID web application G.Dennis Jr et al. Dennis et al.69 R package ‘GSVA’ 1.46.0 Bioconductor H€anzelmann et al.27 R package ‘rms’ 6.5-0 CRAN https://CRAN.R-project.org/ package=maxstat R package ‘survival’ 3.5-3 CRAN https://CRAN.R-project.org/ package=maxstat R package ’maxstat’ 0.7-2.5 CRAN https://CRAN.R-project.org/ package=maxstat R package ’survminer’ 0.4.9 CRAN https://CRAN.R-project.org/ package=survminer R package ’RTCGA’ 1.28.0 Github https://rtcga.github.io/RTCGA PAAD, LUAD and LUSC TCGA datasets Cancer Genome Atlas Research Network Cancer Genome Atlas Research, N.32 R package ’curatedTCGAData’ 1.20.1 Bioconductor Ramos et al.70 R package ’ggpubr’ 0.6.0 N/A https://CRAN.R-project.org/ package=ggpubr R package ’DESeq2’ 1.38.3 Bioconductor N/A R package ’biomaRt’ 2.54.0 Bioconductor N/A R package ’ComplexHeatmap’ 2.14.0 Bioconductor Gu et al.71 R package ’ggplot2’ 3.4.1 CRAN N/A GSVA scores on immune gene sets M S Rooney et al. Rooney et al.72 GSVA scores on T cells low and T cell high tumor samples J Li et al. Li et al.26 FlowJo software BD Biosciences https://www.flowjo.com/solutions/flowjo/ downloads ImageJ software Fiji https://imagej.net/software/fiji/downloads (Continued on next page) e5 Immunity 57, 1378–1393.e1–e14, June 11, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Zen v3.5 software Zeiss https://www.zeiss.com/microscopy/en/ products/software/zeiss-zen.html GraphPad Prism GraphPad https://www.graphpad.com/features Imaris software Imaris https://imaris.oxinst.com/



    Similar Products

    trackrna idt integrated dna technologies  (Addgene inc)
    93
    Addgene inc trackrna idt integrated dna technologies
    Trackrna Idt Integrated Dna Technologies, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/trackrna+idt+integrated+dna+technologies/RNA+motif+plasmid+cloning+backbone+(Plasmid+%23107253)/pm38749447-659-49-69
    Average 93 stars, based on 1 article reviews
    trackrna idt integrated dna technologies - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results